ID: 985775676

View in Genome Browser
Species Human (GRCh38)
Location 5:1840578-1840600
Sequence CCCAGAATTTACATCCACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985775666_985775676 26 Left 985775666 5:1840529-1840551 CCAGGCCTTGGGACGAGTGTGTC No data
Right 985775676 5:1840578-1840600 CCCAGAATTTACATCCACCTGGG No data
985775668_985775676 21 Left 985775668 5:1840534-1840556 CCTTGGGACGAGTGTGTCGGCAC No data
Right 985775676 5:1840578-1840600 CCCAGAATTTACATCCACCTGGG No data
985775672_985775676 -1 Left 985775672 5:1840556-1840578 CCTGCTCTGGGTGGATAGTGTCC No data
Right 985775676 5:1840578-1840600 CCCAGAATTTACATCCACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985775676 Original CRISPR CCCAGAATTTACATCCACCT GGG Intergenic
No off target data available for this crispr