ID: 985776563

View in Genome Browser
Species Human (GRCh38)
Location 5:1847264-1847286
Sequence TCACTCCCACACCCAGTGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985776563_985776570 26 Left 985776563 5:1847264-1847286 CCACGCACTGGGTGTGGGAGTGA No data
Right 985776570 5:1847313-1847335 CCTTACAGAAGAGGGAGTGGAGG No data
985776563_985776565 -6 Left 985776563 5:1847264-1847286 CCACGCACTGGGTGTGGGAGTGA No data
Right 985776565 5:1847281-1847303 GAGTGACTCTCAGACGAGGCAGG No data
985776563_985776564 -10 Left 985776563 5:1847264-1847286 CCACGCACTGGGTGTGGGAGTGA No data
Right 985776564 5:1847277-1847299 GTGGGAGTGACTCTCAGACGAGG No data
985776563_985776566 17 Left 985776563 5:1847264-1847286 CCACGCACTGGGTGTGGGAGTGA No data
Right 985776566 5:1847304-1847326 CAGTGTGCGCCTTACAGAAGAGG No data
985776563_985776568 23 Left 985776563 5:1847264-1847286 CCACGCACTGGGTGTGGGAGTGA No data
Right 985776568 5:1847310-1847332 GCGCCTTACAGAAGAGGGAGTGG No data
985776563_985776567 18 Left 985776563 5:1847264-1847286 CCACGCACTGGGTGTGGGAGTGA No data
Right 985776567 5:1847305-1847327 AGTGTGCGCCTTACAGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985776563 Original CRISPR TCACTCCCACACCCAGTGCG TGG (reversed) Intergenic
No off target data available for this crispr