ID: 985777232

View in Genome Browser
Species Human (GRCh38)
Location 5:1851228-1851250
Sequence GACTCAGGACTGCCTGGACG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985777232_985777245 29 Left 985777232 5:1851228-1851250 CCGCGTCCAGGCAGTCCTGAGTC No data
Right 985777245 5:1851280-1851302 CCCATTCCTTGCTACTCCAGGGG No data
985777232_985777243 28 Left 985777232 5:1851228-1851250 CCGCGTCCAGGCAGTCCTGAGTC No data
Right 985777243 5:1851279-1851301 CCCCATTCCTTGCTACTCCAGGG No data
985777232_985777241 27 Left 985777232 5:1851228-1851250 CCGCGTCCAGGCAGTCCTGAGTC No data
Right 985777241 5:1851278-1851300 CCCCCATTCCTTGCTACTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985777232 Original CRISPR GACTCAGGACTGCCTGGACG CGG (reversed) Intergenic
No off target data available for this crispr