ID: 985778326

View in Genome Browser
Species Human (GRCh38)
Location 5:1856948-1856970
Sequence AGTGGCGGCCCCTCTGGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985778326_985778341 10 Left 985778326 5:1856948-1856970 CCCCACCCAGAGGGGCCGCCACT No data
Right 985778341 5:1856981-1857003 ATGCTGGTCGGAGTGGGCTCCGG No data
985778326_985778335 -6 Left 985778326 5:1856948-1856970 CCCCACCCAGAGGGGCCGCCACT No data
Right 985778335 5:1856965-1856987 GCCACTTCCACGGGGAATGCTGG No data
985778326_985778337 -2 Left 985778326 5:1856948-1856970 CCCCACCCAGAGGGGCCGCCACT No data
Right 985778337 5:1856969-1856991 CTTCCACGGGGAATGCTGGTCGG No data
985778326_985778340 4 Left 985778326 5:1856948-1856970 CCCCACCCAGAGGGGCCGCCACT No data
Right 985778340 5:1856975-1856997 CGGGGAATGCTGGTCGGAGTGGG No data
985778326_985778342 26 Left 985778326 5:1856948-1856970 CCCCACCCAGAGGGGCCGCCACT No data
Right 985778342 5:1856997-1857019 GCTCCGGACCTTCCCGCGTGAGG No data
985778326_985778339 3 Left 985778326 5:1856948-1856970 CCCCACCCAGAGGGGCCGCCACT No data
Right 985778339 5:1856974-1856996 ACGGGGAATGCTGGTCGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985778326 Original CRISPR AGTGGCGGCCCCTCTGGGTG GGG (reversed) Intergenic
No off target data available for this crispr