ID: 985779680

View in Genome Browser
Species Human (GRCh38)
Location 5:1863737-1863759
Sequence ACTGAGAGGCAGAAGGCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985779677_985779680 -4 Left 985779677 5:1863718-1863740 CCTCAGAAGAAAGAATTCAACTG 0: 88
1: 187
2: 324
3: 353
4: 569
Right 985779680 5:1863737-1863759 ACTGAGAGGCAGAAGGCAGAAGG No data
985779676_985779680 -1 Left 985779676 5:1863715-1863737 CCTCCTCAGAAGAAAGAATTCAA 0: 112
1: 242
2: 395
3: 378
4: 569
Right 985779680 5:1863737-1863759 ACTGAGAGGCAGAAGGCAGAAGG No data
985779675_985779680 11 Left 985779675 5:1863703-1863725 CCTCAATTCTGGCCTCCTCAGAA No data
Right 985779680 5:1863737-1863759 ACTGAGAGGCAGAAGGCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985779680 Original CRISPR ACTGAGAGGCAGAAGGCAGA AGG Intergenic
No off target data available for this crispr