ID: 985779883

View in Genome Browser
Species Human (GRCh38)
Location 5:1864991-1865013
Sequence ATAGGTGGGGAGAGGCAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985779883_985779890 -8 Left 985779883 5:1864991-1865013 CCCACCTGCCTCTCCCCACCTAT No data
Right 985779890 5:1865006-1865028 CCACCTATGTCACCTCCACCTGG No data
985779883_985779893 4 Left 985779883 5:1864991-1865013 CCCACCTGCCTCTCCCCACCTAT No data
Right 985779893 5:1865018-1865040 CCTCCACCTGGAGAACCTGCAGG No data
985779883_985779898 22 Left 985779883 5:1864991-1865013 CCCACCTGCCTCTCCCCACCTAT No data
Right 985779898 5:1865036-1865058 GCAGGGCTGTGAATCCCGCACGG No data
985779883_985779894 5 Left 985779883 5:1864991-1865013 CCCACCTGCCTCTCCCCACCTAT No data
Right 985779894 5:1865019-1865041 CTCCACCTGGAGAACCTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985779883 Original CRISPR ATAGGTGGGGAGAGGCAGGT GGG (reversed) Intergenic
No off target data available for this crispr