ID: 985779885

View in Genome Browser
Species Human (GRCh38)
Location 5:1864995-1865017
Sequence TGACATAGGTGGGGAGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985779885_985779893 0 Left 985779885 5:1864995-1865017 CCTGCCTCTCCCCACCTATGTCA No data
Right 985779893 5:1865018-1865040 CCTCCACCTGGAGAACCTGCAGG No data
985779885_985779898 18 Left 985779885 5:1864995-1865017 CCTGCCTCTCCCCACCTATGTCA No data
Right 985779898 5:1865036-1865058 GCAGGGCTGTGAATCCCGCACGG No data
985779885_985779894 1 Left 985779885 5:1864995-1865017 CCTGCCTCTCCCCACCTATGTCA No data
Right 985779894 5:1865019-1865041 CTCCACCTGGAGAACCTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985779885 Original CRISPR TGACATAGGTGGGGAGAGGC AGG (reversed) Intergenic
No off target data available for this crispr