ID: 985779893

View in Genome Browser
Species Human (GRCh38)
Location 5:1865018-1865040
Sequence CCTCCACCTGGAGAACCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985779885_985779893 0 Left 985779885 5:1864995-1865017 CCTGCCTCTCCCCACCTATGTCA No data
Right 985779893 5:1865018-1865040 CCTCCACCTGGAGAACCTGCAGG No data
985779884_985779893 3 Left 985779884 5:1864992-1865014 CCACCTGCCTCTCCCCACCTATG No data
Right 985779893 5:1865018-1865040 CCTCCACCTGGAGAACCTGCAGG No data
985779886_985779893 -4 Left 985779886 5:1864999-1865021 CCTCTCCCCACCTATGTCACCTC No data
Right 985779893 5:1865018-1865040 CCTCCACCTGGAGAACCTGCAGG No data
985779887_985779893 -9 Left 985779887 5:1865004-1865026 CCCCACCTATGTCACCTCCACCT No data
Right 985779893 5:1865018-1865040 CCTCCACCTGGAGAACCTGCAGG No data
985779883_985779893 4 Left 985779883 5:1864991-1865013 CCCACCTGCCTCTCCCCACCTAT No data
Right 985779893 5:1865018-1865040 CCTCCACCTGGAGAACCTGCAGG No data
985779888_985779893 -10 Left 985779888 5:1865005-1865027 CCCACCTATGTCACCTCCACCTG No data
Right 985779893 5:1865018-1865040 CCTCCACCTGGAGAACCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985779893 Original CRISPR CCTCCACCTGGAGAACCTGC AGG Intergenic
No off target data available for this crispr