ID: 985781616

View in Genome Browser
Species Human (GRCh38)
Location 5:1874613-1874635
Sequence CAACCAATTAAGATTTAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985781616_985781617 -2 Left 985781616 5:1874613-1874635 CCACTTTAAATCTTAATTGGTTG No data
Right 985781617 5:1874634-1874656 TGCCTTTTAAATATCATTTAAGG No data
985781616_985781620 3 Left 985781616 5:1874613-1874635 CCACTTTAAATCTTAATTGGTTG No data
Right 985781620 5:1874639-1874661 TTTAAATATCATTTAAGGGCTGG No data
985781616_985781618 -1 Left 985781616 5:1874613-1874635 CCACTTTAAATCTTAATTGGTTG No data
Right 985781618 5:1874635-1874657 GCCTTTTAAATATCATTTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985781616 Original CRISPR CAACCAATTAAGATTTAAAG TGG (reversed) Intergenic
No off target data available for this crispr