ID: 985781979

View in Genome Browser
Species Human (GRCh38)
Location 5:1876376-1876398
Sequence GGCCCTGTCGCCAGGGTTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985781960_985781979 27 Left 985781960 5:1876326-1876348 CCTGGGGCTCGGGGTCCGGCGGC No data
Right 985781979 5:1876376-1876398 GGCCCTGTCGCCAGGGTTCAGGG No data
985781972_985781979 -6 Left 985781972 5:1876359-1876381 CCTCAGGGCCCGGTCCAGGCCCT No data
Right 985781979 5:1876376-1876398 GGCCCTGTCGCCAGGGTTCAGGG No data
985781970_985781979 -4 Left 985781970 5:1876357-1876379 CCCCTCAGGGCCCGGTCCAGGCC No data
Right 985781979 5:1876376-1876398 GGCCCTGTCGCCAGGGTTCAGGG No data
985781971_985781979 -5 Left 985781971 5:1876358-1876380 CCCTCAGGGCCCGGTCCAGGCCC No data
Right 985781979 5:1876376-1876398 GGCCCTGTCGCCAGGGTTCAGGG No data
985781966_985781979 5 Left 985781966 5:1876348-1876370 CCGAGGGTCCCCCTCAGGGCCCG No data
Right 985781979 5:1876376-1876398 GGCCCTGTCGCCAGGGTTCAGGG No data
985781969_985781979 -3 Left 985781969 5:1876356-1876378 CCCCCTCAGGGCCCGGTCCAGGC No data
Right 985781979 5:1876376-1876398 GGCCCTGTCGCCAGGGTTCAGGG No data
985781963_985781979 12 Left 985781963 5:1876341-1876363 CCGGCGGCCGAGGGTCCCCCTCA No data
Right 985781979 5:1876376-1876398 GGCCCTGTCGCCAGGGTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985781979 Original CRISPR GGCCCTGTCGCCAGGGTTCA GGG Intergenic
No off target data available for this crispr