ID: 985782306

View in Genome Browser
Species Human (GRCh38)
Location 5:1877791-1877813
Sequence CAAGCCCGGCGCTGCCACGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 103}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985782306_985782315 23 Left 985782306 5:1877791-1877813 CCGGCGTGGCAGCGCCGGGCTTG 0: 1
1: 0
2: 1
3: 6
4: 103
Right 985782315 5:1877837-1877859 TCAGAAGCCCCCTCTCCGGTGGG 0: 1
1: 0
2: 1
3: 12
4: 84
985782306_985782314 22 Left 985782306 5:1877791-1877813 CCGGCGTGGCAGCGCCGGGCTTG 0: 1
1: 0
2: 1
3: 6
4: 103
Right 985782314 5:1877836-1877858 TTCAGAAGCCCCCTCTCCGGTGG 0: 2
1: 0
2: 1
3: 12
4: 115
985782306_985782318 30 Left 985782306 5:1877791-1877813 CCGGCGTGGCAGCGCCGGGCTTG 0: 1
1: 0
2: 1
3: 6
4: 103
Right 985782318 5:1877844-1877866 CCCCCTCTCCGGTGGGTTGGCGG 0: 1
1: 0
2: 1
3: 16
4: 143
985782306_985782308 -9 Left 985782306 5:1877791-1877813 CCGGCGTGGCAGCGCCGGGCTTG 0: 1
1: 0
2: 1
3: 6
4: 103
Right 985782308 5:1877805-1877827 CCGGGCTTGTCCATGTTCCCAGG 0: 1
1: 0
2: 0
3: 8
4: 177
985782306_985782316 27 Left 985782306 5:1877791-1877813 CCGGCGTGGCAGCGCCGGGCTTG 0: 1
1: 0
2: 1
3: 6
4: 103
Right 985782316 5:1877841-1877863 AAGCCCCCTCTCCGGTGGGTTGG 0: 1
1: 1
2: 0
3: 6
4: 78
985782306_985782313 19 Left 985782306 5:1877791-1877813 CCGGCGTGGCAGCGCCGGGCTTG 0: 1
1: 0
2: 1
3: 6
4: 103
Right 985782313 5:1877833-1877855 AAGTTCAGAAGCCCCCTCTCCGG 0: 1
1: 0
2: 2
3: 4
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985782306 Original CRISPR CAAGCCCGGCGCTGCCACGC CGG (reversed) Exonic
900432314 1:2608142-2608164 CAAGCCCAGCGCACCCAAGCAGG + Intronic
902467976 1:16630022-16630044 CAAGACCGACGGCGCCACGCAGG + Intergenic
903603040 1:24556082-24556104 GCCGCCCGGCGCTGCCACCCTGG - Intergenic
904611642 1:31729082-31729104 CAAACCAGGCGCTGCCTCCCTGG + Intronic
905140583 1:35840757-35840779 ACAGGCAGGCGCTGCCACGCTGG + Intronic
906240256 1:44238389-44238411 CTAGCCCTGCGCTGACACCCAGG - Intronic
907500116 1:54872859-54872881 CAAGACCAGTGCTGCCAAGCTGG + Intronic
918047509 1:180950433-180950455 CAAGCCCAGCCCTGCCACCTTGG - Exonic
920002330 1:202808252-202808274 CGCGCCCGGCGCTGCCCCTCGGG - Exonic
921650666 1:217674425-217674447 CAAGCCAGGCACAGCCAGGCAGG - Intronic
1071527493 10:86366741-86366763 CCAGCCCAGAGCCGCCACGCCGG - Intergenic
1072562179 10:96586697-96586719 CTAGCCCGGGGCGGCCGCGCCGG + Intronic
1072628829 10:97131919-97131941 CAAGCCCAGCTCTGCCACATGGG - Intronic
1076306137 10:129467003-129467025 CAGGCCCGGCGCCGCCGCACAGG + Intergenic
1076809397 10:132878835-132878857 CATGCCTGGCGCTGCCCTGCTGG + Intronic
1077182492 11:1222995-1223017 CAAGCCAGGCCAGGCCACGCAGG - Intergenic
1077419899 11:2445167-2445189 CCAGGCCCGCGCTGCCCCGCCGG - Exonic
1081771755 11:45654472-45654494 CAGGCCCAGCTCTGCCAGGCTGG - Intronic
1085123629 11:73982902-73982924 CAGGCCCGGCCCCGCCCCGCAGG - Exonic
1085527981 11:77175131-77175153 CAAGACCAGGGCTGCCACGCGGG + Intronic
1085784796 11:79440065-79440087 GAAGCCCGGCGCCGCCTCGCGGG + Intronic
1087269069 11:96092750-96092772 CAAGCCGGGCCTTGCCAAGCTGG - Exonic
1087634412 11:100687060-100687082 CAAGCGCGGGGCTGCAGCGCGGG + Intergenic
1091384503 12:84249-84271 CAAGCCCAGTCCTGCCAGGCTGG - Intronic
1100276921 12:93080154-93080176 CAAGGCCGGCCATGCCACGTGGG + Intergenic
1100685995 12:96986213-96986235 CACGGCCTGCGCTGCCAGGCGGG - Intergenic
1103866001 12:124052604-124052626 CCAGCCCGGCGCTACCATGATGG + Intronic
1108727811 13:53201181-53201203 CGAGGCTGGCGCCGCCACGCTGG + Intergenic
1112025054 13:95404087-95404109 CAATCCCAGCTCTGCCACTCAGG - Intergenic
1118767275 14:68918234-68918256 CAAGCCTGCCCCTGCCATGCTGG - Intronic
1121732300 14:96195110-96195132 CCAGCCAGGCCCTGCCAGGCAGG - Intergenic
1122913380 14:104844506-104844528 CAAGCCTGGTGCAGCCACGGTGG + Intergenic
1125754887 15:42056952-42056974 CAAGGCCGGCCCTGCCAGGGTGG - Intergenic
1132609346 16:807530-807552 CAGGCCCGGCGCCTGCACGCGGG - Exonic
1132807823 16:1783150-1783172 CTGGCCCGGCCCAGCCACGCCGG - Intronic
1132837130 16:1959765-1959787 CCAGCCCGGGGCTCCCTCGCCGG + Intronic
1133868971 16:9670364-9670386 CAACCCCAGCGCTGCCACTTAGG + Intronic
1135234341 16:20741639-20741661 CGCGCTCGGCGCTGCGACGCTGG - Exonic
1138651423 16:58463589-58463611 CAGGCCCGGCACCGCCCCGCGGG + Intronic
1140915302 16:79488110-79488132 CACGCCTGGCGCTGCCACCACGG + Intergenic
1142086305 16:88184267-88184289 CAAGCCCCACACTGCCAGGCTGG - Intergenic
1144057887 17:11558305-11558327 CAGCCCCGGCCCTGCCCCGCCGG - Exonic
1147115499 17:38296462-38296484 CAAGCCCGGCGCTCTCTTGCTGG + Intergenic
1147315408 17:39617923-39617945 CAAGCCCGGCTCCCCCAAGCGGG - Intergenic
1148317983 17:46721092-46721114 GAAGCGGGGCTCTGCCACGCAGG - Intronic
1148414175 17:47493135-47493157 CAAGCCCGGCGCTCTCTTGCTGG - Intergenic
1152753689 17:82078144-82078166 GAAGCCCGGGGCTGCCACGCGGG + Intergenic
1155244577 18:23894992-23895014 GAAGCCCTGCGCTGGCACTCAGG - Exonic
1155902686 18:31410908-31410930 CAAGCCCGCAGCAGCCACGGCGG + Intronic
1158876526 18:61739321-61739343 CAAGCCTGGCTCTGTCACCCAGG - Intergenic
1160452446 18:78974518-78974540 CCAGCCCGGCCCCTCCACGCCGG + Intergenic
1160909942 19:1469711-1469733 CGTGCCCGGCGCGGCCACCCTGG - Exonic
1162070514 19:8149580-8149602 CCAGCCCAGAGCTGCCACTCGGG + Exonic
1162109858 19:8394095-8394117 CCAGCCCGCCACTGCCCCGCTGG + Intronic
1162786132 19:13036138-13036160 CAAGCCAGGTGCAGCCAAGCAGG - Intronic
1165015455 19:32877000-32877022 CCTGCCCCGCGCAGCCACGCTGG + Intergenic
1165314009 19:35043918-35043940 CCAGCCCGGAGCTGCCAGGGAGG - Intronic
1166095323 19:40534917-40534939 CAAGCATGGAGCTGCCAAGCTGG - Intronic
1166741064 19:45115111-45115133 CAAGCCCGGCCCTGCCTTCCAGG + Intronic
1168348239 19:55661142-55661164 CAAGCCCGGCGCCTCTACGTGGG + Exonic
925154059 2:1636996-1637018 CAGACCCAGCGCTGCCACCCAGG + Intronic
925185130 2:1842092-1842114 CGGGCCCGGCGCTGGCACACGGG + Intronic
929922409 2:46182106-46182128 CAAGCCAGGAGCATCCACGCCGG - Intronic
933684643 2:85133514-85133536 CGGGCCCGGCGCTGCCCGGCCGG - Exonic
933886214 2:86720819-86720841 CATGCCCCGCGCGCCCACGCGGG - Intronic
936090496 2:109498843-109498865 CAGGCCCGGCGTGGCCACACAGG + Intronic
945869157 2:215208057-215208079 CAAGCACGGTGCTGGCAGGCTGG - Intergenic
946248736 2:218400817-218400839 CCACCCCGGCCCAGCCACGCTGG - Intronic
948823252 2:240560866-240560888 CACGCGCAGCTCTGCCACGCCGG - Exonic
1171347668 20:24478274-24478296 CCTGCCTGGCGCTGCCACTCTGG - Intronic
1172774239 20:37397899-37397921 GGAGCCCGGAGCTGCCACACGGG - Intronic
1174357965 20:50010614-50010636 CCAGCCCGGAGCTGCCATGGTGG + Intergenic
1175036511 20:56005350-56005372 GGAGCGCGGCGCTGCCAGGCCGG + Exonic
1176223135 20:63979413-63979435 CGGCCCCGGCGCGGCCACGCGGG + Exonic
1180089417 21:45526119-45526141 CATGCCCGCCCCTGCCAGGCAGG + Intronic
1180871491 22:19149540-19149562 CAAGCCCCGCCCTGGCGCGCCGG - Intronic
1184508258 22:44917129-44917151 CAGGCCCGCCGCAGTCACGCGGG - Intronic
954362272 3:50128387-50128409 CCAGCCCAGCTCTGCCAAGCAGG + Intergenic
954912795 3:54122709-54122731 CGAGCCCGGCCCGGCCATGCTGG - Exonic
959539863 3:107525222-107525244 CCGGCCCGGCGCTGCCATTCCGG - Intronic
962251474 3:133838587-133838609 CAAGCCAGGCAGTGCCACTCTGG + Intronic
964356236 3:155854254-155854276 CGAGCCCGGCGCTGCTGCCCGGG - Exonic
968876273 4:3269435-3269457 CTGGCTCGGCCCTGCCACGCAGG + Intronic
978385511 4:108172625-108172647 GTAGCTCGGCGCAGCCACGCGGG + Intergenic
985688458 5:1294336-1294358 CCAGCTCGGCGCTGCCACTCAGG - Exonic
985782306 5:1877791-1877813 CAAGCCCGGCGCTGCCACGCCGG - Exonic
989229826 5:39073938-39073960 CGAGCCCGGGGCCGCCTCGCCGG - Intronic
989812375 5:45695022-45695044 AAAGCCAGGCGCTTCCAGGCAGG - Intronic
992078819 5:73215790-73215812 TAAGCCCGGAGCTGCAAAGCTGG + Intergenic
994072767 5:95620608-95620630 CGAGCCCCGCGCGGCCACGGGGG + Exonic
1002100313 5:176854471-176854493 CAAGCCCGGCTGAGCCACACTGG + Intronic
1005478513 6:26233133-26233155 CAAGACCTGCTTTGCCACGCGGG + Intergenic
1006481215 6:34296005-34296027 CAGGCCAGGCACTGCCACTCTGG + Intronic
1007631701 6:43276464-43276486 CACGCGCGGCGCCGCCACGGGGG + Intronic
1019279592 7:193110-193132 CGAGCGCGGCGCCGCCTCGCGGG - Exonic
1019367697 7:643763-643785 AAAGCCCAGAGCTGCCAGGCAGG + Intronic
1019540185 7:1547853-1547875 CAAGCTGGGGGCTGGCACGCTGG - Exonic
1020275516 7:6622340-6622362 CACGGCCGGCGCTGCCACGGCGG - Exonic
1021015485 7:15526112-15526134 CAAGCCAGGCACTGCCCGGCGGG + Intronic
1029605722 7:101598470-101598492 CAAGCCTGGCGCTGACAGCCAGG + Intergenic
1038326571 8:26577167-26577189 GCAGCCCGGCGCCTCCACGCGGG + Intronic
1048328983 8:133459559-133459581 CAAGACATGCTCTGCCACGCTGG + Exonic
1049191470 8:141290325-141290347 CAAGCCCGGCCCTCCCACTCAGG + Intronic
1049411419 8:142475549-142475571 CACGCCCGGCGCGGGCAGGCAGG - Exonic
1049581201 8:143411863-143411885 GAAGCCTGGAGCTGCCCCGCAGG + Intergenic
1060217885 9:121749198-121749220 CAAGCCCAGCCTTGCCCCGCTGG - Intronic
1060793221 9:126499372-126499394 CAGGCCCGGCGCTGCGCAGCTGG + Intronic
1061131907 9:128713173-128713195 CAAGCTCGCCTCGGCCACGCTGG - Exonic
1061318219 9:129810931-129810953 CCAGCCCGGTGCTGCCACAAAGG - Exonic
1185772751 X:2777565-2777587 AAAGCCTGGCTCTGCCACCCAGG - Intronic
1186034839 X:5411263-5411285 CAAGCCTGGCCATGCCACGCGGG + Intergenic