ID: 985783305

View in Genome Browser
Species Human (GRCh38)
Location 5:1881894-1881916
Sequence GCTCAACTCGGCCGCGGCGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 64}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985783305_985783316 30 Left 985783305 5:1881894-1881916 CCAGCGCCGCGGCCGAGTTGAGC 0: 1
1: 0
2: 0
3: 7
4: 64
Right 985783316 5:1881947-1881969 TCGTAGACCGGGCAGTAGACCGG 0: 1
1: 0
2: 0
3: 1
4: 18
985783305_985783310 -7 Left 985783305 5:1881894-1881916 CCAGCGCCGCGGCCGAGTTGAGC 0: 1
1: 0
2: 0
3: 7
4: 64
Right 985783310 5:1881910-1881932 GTTGAGCTCGTGGCGCGCGGTGG 0: 1
1: 0
2: 0
3: 1
4: 43
985783305_985783309 -10 Left 985783305 5:1881894-1881916 CCAGCGCCGCGGCCGAGTTGAGC 0: 1
1: 0
2: 0
3: 7
4: 64
Right 985783309 5:1881907-1881929 CGAGTTGAGCTCGTGGCGCGCGG 0: 1
1: 0
2: 0
3: 1
4: 13
985783305_985783313 18 Left 985783305 5:1881894-1881916 CCAGCGCCGCGGCCGAGTTGAGC 0: 1
1: 0
2: 0
3: 7
4: 64
Right 985783313 5:1881935-1881957 AGCAGCCGGCTCTCGTAGACCGG 0: 1
1: 0
2: 1
3: 2
4: 39
985783305_985783311 4 Left 985783305 5:1881894-1881916 CCAGCGCCGCGGCCGAGTTGAGC 0: 1
1: 0
2: 0
3: 7
4: 64
Right 985783311 5:1881921-1881943 GGCGCGCGGTGGCCAGCAGCCGG 0: 1
1: 0
2: 2
3: 21
4: 168
985783305_985783314 19 Left 985783305 5:1881894-1881916 CCAGCGCCGCGGCCGAGTTGAGC 0: 1
1: 0
2: 0
3: 7
4: 64
Right 985783314 5:1881936-1881958 GCAGCCGGCTCTCGTAGACCGGG 0: 1
1: 0
2: 0
3: 1
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985783305 Original CRISPR GCTCAACTCGGCCGCGGCGC TGG (reversed) Exonic
901007582 1:6179485-6179507 GCCCATGTCGGCCGCGGGGCGGG - Intronic
911116023 1:94247523-94247545 GCTCGCTTCGGCCGCGGCGGTGG - Intronic
924801495 1:247331954-247331976 GCACACCTCGGCCGGGGGGCGGG - Intergenic
1063859785 10:10295084-10295106 GCTCAAGTGGGCCCCAGCGCGGG - Intergenic
1064443101 10:15371047-15371069 GCTCATCTCCGCCGCGGGGCCGG + Exonic
1071526757 10:86363766-86363788 GCCCACCTAGGCAGCGGCGCCGG - Intronic
1071835728 10:89415195-89415217 GCTCTTCTCGGCAGCGGCGACGG + Intronic
1072151845 10:92690226-92690248 GCACCACTCCGCCGCCGCGCTGG + Exonic
1073099528 10:100999562-100999584 GCTCGACGCGGCGGCGGCGGTGG - Exonic
1075801738 10:125159074-125159096 GCCCAACTCGCCCGGGGCGCTGG + Intronic
1077554223 11:3218229-3218251 GCTCCACTCGCCCGCGGCCCAGG - Exonic
1078377556 11:10808672-10808694 GCTCCACTCGGCGGCGGCAGCGG + Intronic
1078594592 11:12674999-12675021 GCTCACCTCGGAGGGGGCGCGGG - Intronic
1084045944 11:66567936-66567958 GCTTTACTCGGCCTCGGGGCGGG + Intronic
1093173177 12:15882148-15882170 TTTCAACTCGGCCGCGGACCAGG + Intronic
1113454489 13:110438465-110438487 GCTCAACTCAGGCGCAGTGCAGG - Intronic
1117251896 14:53946973-53946995 GCTCGGCGCGTCCGCGGCGCGGG - Intergenic
1121803828 14:96797366-96797388 TCGTAACTCGGCAGCGGCGCCGG - Exonic
1129503264 15:76059972-76059994 GCTCGGCTCTGCAGCGGCGCCGG - Exonic
1131249003 15:90818839-90818861 GCTCAACTCTGCAGCTGTGCAGG + Intergenic
1132719779 16:1309888-1309910 GGAAAGCTCGGCCGCGGCGCGGG - Intronic
1137614522 16:49838795-49838817 GCACAAAGCGGCCGCGGCGGGGG - Intronic
1142006960 16:87693948-87693970 GCTCAACACGGCAGCGGCAACGG - Intronic
1142188600 16:88706582-88706604 TCTTACCTGGGCCGCGGCGCCGG - Exonic
1143106510 17:4533058-4533080 GCACAACTTGGGCGCGGTGCAGG - Exonic
1148262286 17:46193722-46193744 ACTCACCTCGGCCGCAGCGAGGG - Intronic
1148534804 17:48430237-48430259 GCCCAGCCCGGCCGCGGGGCGGG + Intronic
1148735581 17:49862930-49862952 GCTAAACTGGGCCGCGGCGTGGG + Intergenic
1154173454 18:12067271-12067293 GCTCAGGCCGGCCACGGCGCCGG + Intergenic
1155221500 18:23689799-23689821 GCTGAGCCCGGCCGCGGCCCCGG - Exonic
1160024097 18:75204702-75204724 TCTCAACTCCACCGCGGCGCCGG - Intronic
1160690968 19:460619-460641 GATCCACTCGGCGGCGGCGGCGG + Exonic
1163631352 19:18419482-18419504 GCTCCAGACGGCCGCGGCGGCGG - Exonic
1163635037 19:18433717-18433739 GCTCAGGCCGGCCACGGCGCCGG - Exonic
929936660 2:46298391-46298413 GCCCACTTGGGCCGCGGCGCGGG - Intronic
934049793 2:88200456-88200478 CCTCAACTGAGCCGCTGCGCGGG + Intergenic
937997083 2:127702129-127702151 GGTCGCCTGGGCCGCGGCGCCGG + Exonic
946415484 2:219537941-219537963 CCTCCACTCGGCCCCGGCTCGGG - Exonic
946908976 2:224442333-224442355 GCGGGACTCGGCCGCGCCGCCGG - Intergenic
947765305 2:232633850-232633872 GCTCAGCTCCGCGTCGGCGCTGG - Exonic
1172245601 20:33443410-33443432 GCTCAACGGCGCCGCGGAGCCGG - Exonic
1178493850 21:33070943-33070965 GCTCTCCCCGGCGGCGGCGCAGG + Exonic
1181270822 22:21657624-21657646 TCTCCCCACGGCCGCGGCGCAGG - Intronic
1181514360 22:23402659-23402681 GCTCACCTGGGCGCCGGCGCGGG + Intergenic
952942570 3:38455091-38455113 GCTCAGCTCGCCCGCGGCTGCGG + Intronic
961698870 3:128726343-128726365 GCTTACCGCGGCCGCTGCGCTGG - Exonic
964358507 3:155871139-155871161 GCTCCCCGCGGCCGCGTCGCTGG + Intronic
968382286 4:107433-107455 GCTCTTCCCGGCCGGGGCGCCGG - Intergenic
975139145 4:70902520-70902542 GCTCATGTTGGCCGCGGGGCAGG - Exonic
984639335 4:182144729-182144751 GCTCGGCTCGCCCGCGCCGCCGG - Intronic
985783305 5:1881894-1881916 GCTCAACTCGGCCGCGGCGCTGG - Exonic
988727324 5:33938048-33938070 GCCCCACGCGGCCGCGGAGCCGG + Exonic
997470633 5:134115139-134115161 GCTCACCTCGGCCTCGCCGCGGG - Exonic
997583023 5:135028946-135028968 GCTCAACTCGGCCATGTCGCCGG - Exonic
1002721036 5:181261565-181261587 GACCAACTCGGCCCCGGCCCGGG - Intergenic
1002784984 6:393433-393455 GCTCGCCTCGGAGGCGGCGCCGG - Intronic
1003290769 6:4776593-4776615 GCACAACCCCGCCGCGCCGCCGG + Exonic
1003948104 6:11093773-11093795 GCTCGCCTCCTCCGCGGCGCGGG - Intergenic
1019331920 7:464534-464556 GCTCAGCTCGGCAGCGTGGCTGG - Intergenic
1022100310 7:27165380-27165402 GCTCAGCTCATCCGCGGCGTCGG + Exonic
1033495062 7:141885999-141886021 GCTCAACTCAGCCCAGGTGCTGG + Intergenic
1034461278 7:151199318-151199340 TGCCAACTCGGCCGCGGGGCGGG - Intronic
1039454278 8:37697228-37697250 ACTCAACTCGGTGGCGGCGGCGG + Exonic
1053399126 9:37801485-37801507 GCTAACCTCGGCCCGGGCGCGGG - Intronic
1057390607 9:94639215-94639237 GGTCAACTCGCCCGTGCCGCGGG + Exonic
1057869774 9:98708883-98708905 GCTCAGAACGGCCGCGGCGGCGG + Exonic
1059769770 9:117414585-117414607 GCGCGACTCGGCGGCGGTGCCGG + Exonic
1060700824 9:125747697-125747719 CCTCGACTCGGCCGCGGGCCCGG - Intronic
1061365815 9:130172164-130172186 GCTCAACGCGGCCCCAGGGCGGG - Intergenic
1061808369 9:133148856-133148878 GCTCAGCGTGGACGCGGCGCCGG + Intronic
1062022510 9:134326205-134326227 TCTCAACTCGGCGGCCGGGCGGG + Intronic
1062659074 9:137619033-137619055 GCTCACCTCGGCATCGGCGGCGG - Exonic