ID: 985783533

View in Genome Browser
Species Human (GRCh38)
Location 5:1882654-1882676
Sequence CGCGGCCCGGGGCGGACGGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 474
Summary {0: 1, 1: 2, 2: 3, 3: 47, 4: 421}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985783523_985783533 3 Left 985783523 5:1882628-1882650 CCAAACTGCGGGTAGGACATGGC 0: 1
1: 0
2: 0
3: 2
4: 47
Right 985783533 5:1882654-1882676 CGCGGCCCGGGGCGGACGGGCGG 0: 1
1: 2
2: 3
3: 47
4: 421
985783518_985783533 20 Left 985783518 5:1882611-1882633 CCGAGGAGTAGGGGTATCCAAAC 0: 1
1: 0
2: 1
3: 3
4: 44
Right 985783533 5:1882654-1882676 CGCGGCCCGGGGCGGACGGGCGG 0: 1
1: 2
2: 3
3: 47
4: 421
985783516_985783533 29 Left 985783516 5:1882602-1882624 CCTGGGGAGCCGAGGAGTAGGGG 0: 1
1: 0
2: 0
3: 21
4: 290
Right 985783533 5:1882654-1882676 CGCGGCCCGGGGCGGACGGGCGG 0: 1
1: 2
2: 3
3: 47
4: 421

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985783533 Original CRISPR CGCGGCCCGGGGCGGACGGG CGG Exonic