ID: 985784571

View in Genome Browser
Species Human (GRCh38)
Location 5:1887061-1887083
Sequence GAGCGGCCCAGCGCCACCGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 122}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985784571_985784581 12 Left 985784571 5:1887061-1887083 CCTGCGGTGGCGCTGGGCCGCTC 0: 1
1: 0
2: 1
3: 6
4: 122
Right 985784581 5:1887096-1887118 GAGGGCTCCGCGCGGAAGCTCGG 0: 1
1: 0
2: 0
3: 4
4: 79
985784571_985784578 4 Left 985784571 5:1887061-1887083 CCTGCGGTGGCGCTGGGCCGCTC 0: 1
1: 0
2: 1
3: 6
4: 122
Right 985784578 5:1887088-1887110 CAGCCCGCGAGGGCTCCGCGCGG 0: 1
1: 0
2: 0
3: 10
4: 116
985784571_985784583 29 Left 985784571 5:1887061-1887083 CCTGCGGTGGCGCTGGGCCGCTC 0: 1
1: 0
2: 1
3: 6
4: 122
Right 985784583 5:1887113-1887135 GCTCGGCGCGCGCGCTCCAGCGG 0: 1
1: 0
2: 0
3: 3
4: 64
985784571_985784575 -6 Left 985784571 5:1887061-1887083 CCTGCGGTGGCGCTGGGCCGCTC 0: 1
1: 0
2: 1
3: 6
4: 122
Right 985784575 5:1887078-1887100 CCGCTCCCGGCAGCCCGCGAGGG 0: 1
1: 0
2: 3
3: 10
4: 123
985784571_985784573 -7 Left 985784571 5:1887061-1887083 CCTGCGGTGGCGCTGGGCCGCTC 0: 1
1: 0
2: 1
3: 6
4: 122
Right 985784573 5:1887077-1887099 GCCGCTCCCGGCAGCCCGCGAGG 0: 1
1: 0
2: 2
3: 27
4: 208
985784571_985784584 30 Left 985784571 5:1887061-1887083 CCTGCGGTGGCGCTGGGCCGCTC 0: 1
1: 0
2: 1
3: 6
4: 122
Right 985784584 5:1887114-1887136 CTCGGCGCGCGCGCTCCAGCGGG 0: 1
1: 0
2: 0
3: 5
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985784571 Original CRISPR GAGCGGCCCAGCGCCACCGC AGG (reversed) Exonic
900181793 1:1314334-1314356 GCGCGGCCCAGCGCGAACACAGG + Exonic
901443572 1:9293405-9293427 GAGCGCCCCAGCCCCTCCTCGGG - Intronic
901660107 1:10794003-10794025 GAACGGCCCAGCGCCCCCTCCGG + Intronic
904469810 1:30729355-30729377 GAGCAGCCCAGCTGCACTGCAGG - Intergenic
905448337 1:38042090-38042112 GCGCGGCCCAGAGCCTCAGCAGG - Intergenic
907459147 1:54594802-54594824 GAGAGGCCCAGGGCCACCAGTGG - Intronic
913193482 1:116433291-116433313 GAGTGGCCCTGAGCCACAGCTGG + Intergenic
918332405 1:183472539-183472561 GAGCGGCCCCGCGGCACCGCGGG - Exonic
918951994 1:191151517-191151539 GAGCGGCCCGCCGGCACCACCGG + Intergenic
920071446 1:203305762-203305784 GAGGGGCCTGGCGCCACCGGGGG + Intronic
920305442 1:205015455-205015477 GAGCAGCCCCGCGCCTCCTCAGG + Intronic
922783096 1:228268944-228268966 AAGCAGCCCAGCTCCACCACAGG - Intronic
1072970020 10:100009673-100009695 GCGCAGCACAGCGCCGCCGCTGG + Intronic
1078602168 11:12742985-12743007 GCACTGCCCAGCCCCACCGCTGG - Intronic
1079128857 11:17735959-17735981 GCGCGGCCCAGCGACACCCATGG - Exonic
1080458447 11:32434967-32434989 GGGCGGCCCCGCGCCGCCACCGG - Exonic
1084003940 11:66313532-66313554 GAGTGGCCCAGCGCCCCCTTCGG - Intergenic
1084935218 11:72583320-72583342 GATAGGCCCAGAGCCACAGCAGG - Intronic
1085896382 11:80644534-80644556 GAGATGCCCTGCGCCACCTCAGG + Intergenic
1087141266 11:94768249-94768271 CAGCGGCCGGGCGCCACGGCGGG + Intronic
1090417378 11:126549846-126549868 GAGCTGCCCACCGCCTCGGCAGG + Intronic
1091915512 12:4269898-4269920 CAGCGGCCCAGCGCCCCGGCGGG + Intergenic
1096787722 12:54027230-54027252 GAGAGGCCCATCCCCACCACGGG + Intronic
1098161311 12:67649546-67649568 GCGCGGCCCGGCTCCCCCGCCGG + Intronic
1103702301 12:122854186-122854208 GAGTGGCCCAGGGCAACCCCTGG + Intronic
1107467791 13:40665778-40665800 GAGCGGCCCAGCGGCGGCGGGGG + Exonic
1108380274 13:49848113-49848135 GCGCGGCCGAGCGCCGCTGCGGG + Intergenic
1108845653 13:54676662-54676684 GAGCGGCCCACCGGCGCCACTGG + Intergenic
1113609476 13:111633096-111633118 GGGCGGCTCAGCCCCACCTCAGG + Intronic
1114461197 14:22887053-22887075 GAGCGGCCCCGGGCCGCCCCCGG - Exonic
1115502166 14:34059912-34059934 GACCGGCCCTGGGCCTCCGCAGG + Intronic
1117183667 14:53217779-53217801 GAGCAGCCCGCCGGCACCGCCGG - Intergenic
1118925686 14:70188469-70188491 CAGCGGCTCATCGCCCCCGCGGG + Exonic
1119936688 14:78598472-78598494 GAGCGTCCCAGCGCTGCAGCTGG - Intronic
1121914880 14:97829640-97829662 CAGCAGCCCATGGCCACCGCTGG - Intergenic
1128841344 15:70853835-70853857 GCGCGGCCCGGCGCCCCCTCGGG + Intronic
1129201649 15:74005910-74005932 GAGCGGCCCTGTTCCACTGCAGG - Intronic
1130224554 15:82046979-82047001 GAGCGCCGCGCCGCCACCGCGGG + Intergenic
1132580009 16:680402-680424 GCCCGGCCCAGCTCCGCCGCCGG - Exonic
1133033831 16:3023882-3023904 GAGGGGCCCAGCGCCTCCCGCGG - Exonic
1133464859 16:6019505-6019527 GAGCGCCCCCGCCCCACCGCGGG - Intronic
1134024646 16:10944644-10944666 GAGCGGCCCAGCGCCCGCGGCGG - Exonic
1134584048 16:15395926-15395948 GCGCGGCCCGGCGCCACCCGTGG + Exonic
1136485554 16:30569903-30569925 GTGCGGCTGAGCGGCACCGCAGG - Exonic
1137676183 16:50304926-50304948 GCGTTCCCCAGCGCCACCGCCGG + Exonic
1139469367 16:67170112-67170134 CAGCGGCCCCGCGCCAGCCCTGG - Intergenic
1141558471 16:84851607-84851629 GAGCCGCGCCACGCCACCGCAGG - Intronic
1141626814 16:85265831-85265853 GAGCAGCCCAGGGCCAGGGCAGG + Intergenic
1141959211 16:87392879-87392901 GAACGGCCCAGCGCGGCCCCGGG - Intronic
1142081824 16:88153280-88153302 GTGGAGCCCAGCACCACCGCAGG - Intergenic
1142349036 16:89571344-89571366 CAGGGGCCCAGGGCCACTGCTGG + Intergenic
1142849305 17:2696578-2696600 GCGCAGCCCAGCTCCACCGGTGG - Intronic
1144747237 17:17623967-17623989 GAGCGGGGCAGCGCCATGGCAGG + Intergenic
1146487352 17:33254166-33254188 CAGCAGCCCAGAGCCACCTCTGG - Intronic
1152223506 17:79082090-79082112 CAGCGGCCCAGTGCCTCCCCTGG + Intronic
1152609096 17:81306944-81306966 GAGCCGCCCAGTGCCAGAGCCGG + Intergenic
1152654944 17:81515008-81515030 GAGTGGCCCGGCGCCTCCGAGGG + Intronic
1152715877 17:81900458-81900480 GAGGGTCCCAGGGCCGCCGCCGG - Intronic
1152760071 17:82103187-82103209 GAGGGGCCCAGGGCCAGGGCTGG - Intronic
1153194015 18:2573005-2573027 GAGGCGGCCAGCACCACCGCTGG - Exonic
1155002955 18:21704476-21704498 CCGCGGCCCTGCGCCACCCCCGG + Intronic
1160717295 19:582169-582191 GAGCTGCCCCGAGCCACCCCTGG + Intronic
1162479285 19:10919424-10919446 GACCGGCACAACGCCACCGAGGG - Intronic
1163114174 19:15179232-15179254 CTGCGGCCCAGGCCCACCGCTGG - Exonic
1163304818 19:16471600-16471622 ATGCAGCCCAGCGCCTCCGCGGG + Intronic
1163714941 19:18868058-18868080 AAGCGGCCCAGCCCAACAGCCGG - Exonic
1166142222 19:40811320-40811342 TAGCCGCACAGCCCCACCGCAGG + Intronic
1166185299 19:41135474-41135496 TAGCCGCACAGCACCACCGCAGG - Intergenic
1166551607 19:43669240-43669262 GAGCGGCGCAGAGCCAGTGCTGG - Intronic
1166876964 19:45903123-45903145 GAGCGGCCCAGCGCAGGGGCGGG - Intergenic
1166983960 19:46648976-46648998 CCGCGGCCCAGCGCCCACGCTGG - Exonic
1168339382 19:55614646-55614668 GAACGGGCCATCGCCACCCCCGG - Exonic
927472503 2:23386163-23386185 GAGCGGCCCAGGGCCCCGGCCGG + Intronic
929453001 2:42048672-42048694 GAGCGCCACCGCGGCACCGCCGG - Exonic
929789814 2:45014143-45014165 GAGCCGCGGAGCTCCACCGCCGG + Intergenic
931671611 2:64653485-64653507 GAGGGGCCGGGCGCCGCCGCGGG - Intronic
932231637 2:70088170-70088192 GAGCGGGCCATCACCATCGCTGG + Exonic
932358121 2:71083418-71083440 GAGCAGCCCAGCACCTCCACTGG - Intergenic
932370460 2:71182985-71183007 GAGCAGCCCAGCACCTCCACTGG - Exonic
932409230 2:71535349-71535371 GAGGGACCCAGCGCCCCCTCAGG - Intronic
933970148 2:87463638-87463660 GACCTGCCGAGTGCCACCGCAGG - Intergenic
936323634 2:111486858-111486880 GACCTGCCGAGTGCCACCGCAGG + Intergenic
938949815 2:136245679-136245701 GAGCTGCCCAGGACCACTGCTGG + Intergenic
945225713 2:207529845-207529867 GAGCGGCCCCGCCCCCGCGCTGG - Intronic
948953847 2:241272462-241272484 GAGCGGCCCAGCGGCGCCACCGG + Intronic
949021408 2:241743149-241743171 GAGAGGCCCAGCTCCAGAGCAGG - Intronic
1168851807 20:982028-982050 GAGCAGCCCAGAGCAACCACTGG + Intronic
1175888526 20:62305773-62305795 CCGCGGCCCAGGGCCACGGCAGG - Intronic
1176013246 20:62911998-62912020 GAGCTCCCCAGCACCTCCGCAGG + Intronic
1180035325 21:45245423-45245445 GAGCTGCCAAGGGCCAGCGCTGG - Intergenic
1180166812 21:46034694-46034716 GAGAGGCCCATCCACACCGCAGG - Intergenic
1180166882 21:46034974-46034996 GAGAGGCCCATCCACACCGCAGG - Intergenic
1180166978 21:46035366-46035388 GAGAGGCCCATCCACACCGCAGG - Intergenic
1180177783 21:46098604-46098626 GAGAGGCCCTGCGCCCCCGGAGG - Intronic
1180184995 21:46135096-46135118 GAGCTGCCCAGGGCCTCTGCAGG + Intergenic
950487598 3:13282449-13282471 GAGCTGCTCAGCGCTCCCGCCGG - Intergenic
961698969 3:128726658-128726680 GGGCGGCCCTGCGCCGCGGCAGG + Intronic
968651926 4:1763580-1763602 GGCCAGGCCAGCGCCACCGCAGG + Intergenic
968775452 4:2537024-2537046 GAACCGCGCAGCGCCGCCGCCGG - Intronic
968972322 4:3802450-3802472 GAGAGGCCCAGCCTCACAGCAGG - Intergenic
970574593 4:17414555-17414577 GAGCGGCCTGCCGGCACCGCTGG - Intergenic
985784571 5:1887061-1887083 GAGCGGCCCAGCGCCACCGCAGG - Exonic
995402509 5:111758038-111758060 GCGCGGCTCCGCGCCGCCGCAGG - Intronic
999232324 5:150069104-150069126 GTGAGGCCCAGCGCGGCCGCAGG + Intronic
1001342626 5:170861920-170861942 GAGCGGCGCAGGGACCCCGCGGG + Exonic
1001570141 5:172725490-172725512 GGGCGGCTCAGAGCCACGGCCGG + Intergenic
1002524608 5:179808019-179808041 GACTGGCCCAGCGCCGCCTCTGG + Intronic
1003860385 6:10317351-10317373 AAGGGGCCCAGGGCCACCACTGG + Intergenic
1003901579 6:10659979-10660001 GAGCGGCCGGGCGACCCCGCCGG + Intergenic
1006108200 6:31729130-31729152 CAGCGGCCCAGCCCCTCCCCCGG + Exonic
1006130773 6:31868220-31868242 CAGCAGCCCAGCGCCACTCCCGG + Intronic
1007705011 6:43785237-43785259 GAGAGGCTCAGCGCCAGGGCTGG - Exonic
1010378431 6:75201890-75201912 GAGCGCCCCACTGCCTCCGCGGG + Intronic
1018028197 6:159821908-159821930 GCCCGGCCCTGCTCCACCGCTGG - Intergenic
1019499932 7:1359798-1359820 CAGCTGCCCAGCCCCACCCCGGG - Intergenic
1020114815 7:5470506-5470528 GAGCTGCCCAGAGAAACCGCAGG + Intronic
1029640471 7:101816559-101816581 GGGCGGGCGGGCGCCACCGCCGG - Intronic
1032057764 7:128697421-128697443 GGGCAGCCCGGCGCCACTGCCGG + Intergenic
1035966811 8:4201393-4201415 CAGGCGCCCAGCGCCACCCCCGG - Intronic
1037876446 8:22551269-22551291 GACCGGCCGCGCGCCGCCGCAGG + Intronic
1049398965 8:142416337-142416359 GAGCGGCCCATCCACACAGCAGG - Intergenic
1053011754 9:34637658-34637680 GCGCGGCCCACGCCCACCGCCGG + Exonic
1053489680 9:38489161-38489183 GAGCGGCCCTGCACCCCCTCTGG - Intergenic
1060899501 9:127245156-127245178 CAGCGGGCCAGCTCCACTGCGGG - Intronic
1061453513 9:130681668-130681690 GAGCGCGCCCGCGCCCCCGCCGG + Exonic
1061790898 9:133058291-133058313 CAGCTGCCCAGCTCCACCTCCGG - Exonic
1061899448 9:133665617-133665639 CAGCCTCCCAGCTCCACCGCCGG + Intronic
1186350243 X:8732369-8732391 GAGGGGCCCAGCTCCCACGCAGG + Intergenic
1188248650 X:27864180-27864202 CAGAGGCCCAGCGCGTCCGCAGG - Intergenic
1200746961 Y:6911336-6911358 GCTGGGCCCAGCGCCACTGCTGG + Intronic