ID: 985785204

View in Genome Browser
Species Human (GRCh38)
Location 5:1889713-1889735
Sequence CTGGAAACTCAGCAGGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985785204_985785210 -7 Left 985785204 5:1889713-1889735 CCACCCTCCTGCTGAGTTTCCAG No data
Right 985785210 5:1889729-1889751 TTTCCAGGCGCTCTGAGGAAAGG No data
985785204_985785216 22 Left 985785204 5:1889713-1889735 CCACCCTCCTGCTGAGTTTCCAG No data
Right 985785216 5:1889758-1889780 ATTCCCAGGTCTTGGCCAGGAGG No data
985785204_985785212 -3 Left 985785204 5:1889713-1889735 CCACCCTCCTGCTGAGTTTCCAG No data
Right 985785212 5:1889733-1889755 CAGGCGCTCTGAGGAAAGGATGG No data
985785204_985785213 8 Left 985785204 5:1889713-1889735 CCACCCTCCTGCTGAGTTTCCAG No data
Right 985785213 5:1889744-1889766 AGGAAAGGATGGAAATTCCCAGG No data
985785204_985785214 14 Left 985785204 5:1889713-1889735 CCACCCTCCTGCTGAGTTTCCAG No data
Right 985785214 5:1889750-1889772 GGATGGAAATTCCCAGGTCTTGG No data
985785204_985785219 27 Left 985785204 5:1889713-1889735 CCACCCTCCTGCTGAGTTTCCAG No data
Right 985785219 5:1889763-1889785 CAGGTCTTGGCCAGGAGGCCTGG No data
985785204_985785215 19 Left 985785204 5:1889713-1889735 CCACCCTCCTGCTGAGTTTCCAG No data
Right 985785215 5:1889755-1889777 GAAATTCCCAGGTCTTGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985785204 Original CRISPR CTGGAAACTCAGCAGGAGGG TGG (reversed) Intergenic
No off target data available for this crispr