ID: 985785791

View in Genome Browser
Species Human (GRCh38)
Location 5:1893457-1893479
Sequence CCATCCCTGCACAAGCTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985785786_985785791 0 Left 985785786 5:1893434-1893456 CCAGCCTATTCTCTAGATTCTGT No data
Right 985785791 5:1893457-1893479 CCATCCCTGCACAAGCTGGTGGG No data
985785784_985785791 13 Left 985785784 5:1893421-1893443 CCGTGCTCTCTACCCAGCCTATT No data
Right 985785791 5:1893457-1893479 CCATCCCTGCACAAGCTGGTGGG No data
985785785_985785791 1 Left 985785785 5:1893433-1893455 CCCAGCCTATTCTCTAGATTCTG No data
Right 985785791 5:1893457-1893479 CCATCCCTGCACAAGCTGGTGGG No data
985785787_985785791 -4 Left 985785787 5:1893438-1893460 CCTATTCTCTAGATTCTGTCCAT No data
Right 985785791 5:1893457-1893479 CCATCCCTGCACAAGCTGGTGGG No data
985785781_985785791 21 Left 985785781 5:1893413-1893435 CCTGGGCCCCGTGCTCTCTACCC No data
Right 985785791 5:1893457-1893479 CCATCCCTGCACAAGCTGGTGGG No data
985785783_985785791 14 Left 985785783 5:1893420-1893442 CCCGTGCTCTCTACCCAGCCTAT No data
Right 985785791 5:1893457-1893479 CCATCCCTGCACAAGCTGGTGGG No data
985785782_985785791 15 Left 985785782 5:1893419-1893441 CCCCGTGCTCTCTACCCAGCCTA No data
Right 985785791 5:1893457-1893479 CCATCCCTGCACAAGCTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985785791 Original CRISPR CCATCCCTGCACAAGCTGGT GGG Intergenic
No off target data available for this crispr