ID: 985786950

View in Genome Browser
Species Human (GRCh38)
Location 5:1901260-1901282
Sequence ACCGTTGTTTGTCTCATGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985786950_985786953 17 Left 985786950 5:1901260-1901282 CCAAGCATGAGACAAACAACGGT No data
Right 985786953 5:1901300-1901322 ACCACCACCAGCCGTTCCCAAGG No data
985786950_985786955 18 Left 985786950 5:1901260-1901282 CCAAGCATGAGACAAACAACGGT No data
Right 985786955 5:1901301-1901323 CCACCACCAGCCGTTCCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985786950 Original CRISPR ACCGTTGTTTGTCTCATGCT TGG (reversed) Intergenic
No off target data available for this crispr