ID: 985786951

View in Genome Browser
Species Human (GRCh38)
Location 5:1901283-1901305
Sequence GGTGGTTGCTTCTTGGCAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985786951_985786955 -5 Left 985786951 5:1901283-1901305 CCTCTTGCCAAGAAGCAACCACC No data
Right 985786955 5:1901301-1901323 CCACCACCAGCCGTTCCCAAGGG No data
985786951_985786953 -6 Left 985786951 5:1901283-1901305 CCTCTTGCCAAGAAGCAACCACC No data
Right 985786953 5:1901300-1901322 ACCACCACCAGCCGTTCCCAAGG No data
985786951_985786963 20 Left 985786951 5:1901283-1901305 CCTCTTGCCAAGAAGCAACCACC No data
Right 985786963 5:1901326-1901348 CAGACTCACGAATTCCACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985786951 Original CRISPR GGTGGTTGCTTCTTGGCAAG AGG (reversed) Intergenic
No off target data available for this crispr