ID: 985786955

View in Genome Browser
Species Human (GRCh38)
Location 5:1901301-1901323
Sequence CCACCACCAGCCGTTCCCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985786950_985786955 18 Left 985786950 5:1901260-1901282 CCAAGCATGAGACAAACAACGGT No data
Right 985786955 5:1901301-1901323 CCACCACCAGCCGTTCCCAAGGG No data
985786951_985786955 -5 Left 985786951 5:1901283-1901305 CCTCTTGCCAAGAAGCAACCACC No data
Right 985786955 5:1901301-1901323 CCACCACCAGCCGTTCCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985786955 Original CRISPR CCACCACCAGCCGTTCCCAA GGG Intergenic
No off target data available for this crispr