ID: 985788316

View in Genome Browser
Species Human (GRCh38)
Location 5:1911446-1911468
Sequence CATGTTCAGCAGTCAGTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985788305_985788316 25 Left 985788305 5:1911398-1911420 CCTGCCTCCCCATCCATAGAAGG No data
Right 985788316 5:1911446-1911468 CATGTTCAGCAGTCAGTGTCTGG No data
985788310_985788316 16 Left 985788310 5:1911407-1911429 CCATCCATAGAAGGCTGCCTCCG No data
Right 985788316 5:1911446-1911468 CATGTTCAGCAGTCAGTGTCTGG No data
985788307_985788316 21 Left 985788307 5:1911402-1911424 CCTCCCCATCCATAGAAGGCTGC No data
Right 985788316 5:1911446-1911468 CATGTTCAGCAGTCAGTGTCTGG No data
985788314_985788316 -4 Left 985788314 5:1911427-1911449 CCGCCTGCACGGATGACAACATG No data
Right 985788316 5:1911446-1911468 CATGTTCAGCAGTCAGTGTCTGG No data
985788311_985788316 12 Left 985788311 5:1911411-1911433 CCATAGAAGGCTGCCTCCGCCTG No data
Right 985788316 5:1911446-1911468 CATGTTCAGCAGTCAGTGTCTGG No data
985788309_985788316 17 Left 985788309 5:1911406-1911428 CCCATCCATAGAAGGCTGCCTCC No data
Right 985788316 5:1911446-1911468 CATGTTCAGCAGTCAGTGTCTGG No data
985788313_985788316 -1 Left 985788313 5:1911424-1911446 CCTCCGCCTGCACGGATGACAAC No data
Right 985788316 5:1911446-1911468 CATGTTCAGCAGTCAGTGTCTGG No data
985788315_985788316 -7 Left 985788315 5:1911430-1911452 CCTGCACGGATGACAACATGTTC No data
Right 985788316 5:1911446-1911468 CATGTTCAGCAGTCAGTGTCTGG No data
985788304_985788316 26 Left 985788304 5:1911397-1911419 CCCTGCCTCCCCATCCATAGAAG No data
Right 985788316 5:1911446-1911468 CATGTTCAGCAGTCAGTGTCTGG No data
985788308_985788316 18 Left 985788308 5:1911405-1911427 CCCCATCCATAGAAGGCTGCCTC No data
Right 985788316 5:1911446-1911468 CATGTTCAGCAGTCAGTGTCTGG No data
985788303_985788316 29 Left 985788303 5:1911394-1911416 CCACCCTGCCTCCCCATCCATAG No data
Right 985788316 5:1911446-1911468 CATGTTCAGCAGTCAGTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985788316 Original CRISPR CATGTTCAGCAGTCAGTGTC TGG Intergenic
No off target data available for this crispr