ID: 985789333

View in Genome Browser
Species Human (GRCh38)
Location 5:1916760-1916782
Sequence ATGCCAGGCGGTAAACCTGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985789324_985789333 -1 Left 985789324 5:1916738-1916760 CCCCACTGCCTGCCACCGGGCAA No data
Right 985789333 5:1916760-1916782 ATGCCAGGCGGTAAACCTGGCGG No data
985789319_985789333 21 Left 985789319 5:1916716-1916738 CCGTCCCTCAGCTCTGCTCTATC No data
Right 985789333 5:1916760-1916782 ATGCCAGGCGGTAAACCTGGCGG No data
985789320_985789333 17 Left 985789320 5:1916720-1916742 CCCTCAGCTCTGCTCTATCCCCA No data
Right 985789333 5:1916760-1916782 ATGCCAGGCGGTAAACCTGGCGG No data
985789325_985789333 -2 Left 985789325 5:1916739-1916761 CCCACTGCCTGCCACCGGGCAAT No data
Right 985789333 5:1916760-1916782 ATGCCAGGCGGTAAACCTGGCGG No data
985789318_985789333 24 Left 985789318 5:1916713-1916735 CCTCCGTCCCTCAGCTCTGCTCT No data
Right 985789333 5:1916760-1916782 ATGCCAGGCGGTAAACCTGGCGG No data
985789326_985789333 -3 Left 985789326 5:1916740-1916762 CCACTGCCTGCCACCGGGCAATG No data
Right 985789333 5:1916760-1916782 ATGCCAGGCGGTAAACCTGGCGG No data
985789321_985789333 16 Left 985789321 5:1916721-1916743 CCTCAGCTCTGCTCTATCCCCAC No data
Right 985789333 5:1916760-1916782 ATGCCAGGCGGTAAACCTGGCGG No data
985789328_985789333 -9 Left 985789328 5:1916746-1916768 CCTGCCACCGGGCAATGCCAGGC No data
Right 985789333 5:1916760-1916782 ATGCCAGGCGGTAAACCTGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985789333 Original CRISPR ATGCCAGGCGGTAAACCTGG CGG Intergenic
No off target data available for this crispr