ID: 985789511

View in Genome Browser
Species Human (GRCh38)
Location 5:1917807-1917829
Sequence CAGCTCGGAACACCTGGCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985789511_985789518 29 Left 985789511 5:1917807-1917829 CCACTGCCAGGTGTTCCGAGCTG No data
Right 985789518 5:1917859-1917881 CCTCTCGTTAGTCTGTCGTAAGG No data
985789511_985789519 30 Left 985789511 5:1917807-1917829 CCACTGCCAGGTGTTCCGAGCTG No data
Right 985789519 5:1917860-1917882 CTCTCGTTAGTCTGTCGTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985789511 Original CRISPR CAGCTCGGAACACCTGGCAG TGG (reversed) Intergenic
No off target data available for this crispr