ID: 985791618

View in Genome Browser
Species Human (GRCh38)
Location 5:1931215-1931237
Sequence GCGCAGCTGCGCCCTGGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985791618_985791628 15 Left 985791618 5:1931215-1931237 CCTGCTCCAGGGCGCAGCTGCGC No data
Right 985791628 5:1931253-1931275 CCGGGTCTGCGTGGCCTGCTCGG No data
985791618_985791629 23 Left 985791618 5:1931215-1931237 CCTGCTCCAGGGCGCAGCTGCGC No data
Right 985791629 5:1931261-1931283 GCGTGGCCTGCTCGGCTCAGAGG No data
985791618_985791624 6 Left 985791618 5:1931215-1931237 CCTGCTCCAGGGCGCAGCTGCGC No data
Right 985791624 5:1931244-1931266 CAGCGCCTCCCGGGTCTGCGTGG No data
985791618_985791621 -3 Left 985791618 5:1931215-1931237 CCTGCTCCAGGGCGCAGCTGCGC No data
Right 985791621 5:1931235-1931257 CGCCCGCTTCAGCGCCTCCCGGG No data
985791618_985791620 -4 Left 985791618 5:1931215-1931237 CCTGCTCCAGGGCGCAGCTGCGC No data
Right 985791620 5:1931234-1931256 GCGCCCGCTTCAGCGCCTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985791618 Original CRISPR GCGCAGCTGCGCCCTGGAGC AGG (reversed) Intergenic