ID: 985791652

View in Genome Browser
Species Human (GRCh38)
Location 5:1931373-1931395
Sequence CCTCACCTGCAGAGGGAAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985791652_985791661 14 Left 985791652 5:1931373-1931395 CCGCCTTCCCTCTGCAGGTGAGG No data
Right 985791661 5:1931410-1931432 CGTTTGGAATGTGCCTTTGCCGG No data
985791652_985791660 -2 Left 985791652 5:1931373-1931395 CCGCCTTCCCTCTGCAGGTGAGG No data
Right 985791660 5:1931394-1931416 GGAATGGGGTCTGCTTCGTTTGG No data
985791652_985791662 15 Left 985791652 5:1931373-1931395 CCGCCTTCCCTCTGCAGGTGAGG No data
Right 985791662 5:1931411-1931433 GTTTGGAATGTGCCTTTGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985791652 Original CRISPR CCTCACCTGCAGAGGGAAGG CGG (reversed) Intergenic
No off target data available for this crispr