ID: 985793787

View in Genome Browser
Species Human (GRCh38)
Location 5:1947196-1947218
Sequence ATACACCCTTCAGGGGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985793787_985793802 24 Left 985793787 5:1947196-1947218 CCTCCCTCCCCTGAAGGGTGTAT No data
Right 985793802 5:1947243-1947265 GCCACCAACCACCTTGGGAGTGG No data
985793787_985793804 25 Left 985793787 5:1947196-1947218 CCTCCCTCCCCTGAAGGGTGTAT No data
Right 985793804 5:1947244-1947266 CCACCAACCACCTTGGGAGTGGG No data
985793787_985793801 19 Left 985793787 5:1947196-1947218 CCTCCCTCCCCTGAAGGGTGTAT No data
Right 985793801 5:1947238-1947260 AATTTGCCACCAACCACCTTGGG No data
985793787_985793800 18 Left 985793787 5:1947196-1947218 CCTCCCTCCCCTGAAGGGTGTAT No data
Right 985793800 5:1947237-1947259 CAATTTGCCACCAACCACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985793787 Original CRISPR ATACACCCTTCAGGGGAGGG AGG (reversed) Intergenic
No off target data available for this crispr