ID: 985793793

View in Genome Browser
Species Human (GRCh38)
Location 5:1947205-1947227
Sequence AAGGGGACCATACACCCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985793793_985793801 10 Left 985793793 5:1947205-1947227 CCTGAAGGGTGTATGGTCCCCTT No data
Right 985793801 5:1947238-1947260 AATTTGCCACCAACCACCTTGGG No data
985793793_985793802 15 Left 985793793 5:1947205-1947227 CCTGAAGGGTGTATGGTCCCCTT No data
Right 985793802 5:1947243-1947265 GCCACCAACCACCTTGGGAGTGG No data
985793793_985793800 9 Left 985793793 5:1947205-1947227 CCTGAAGGGTGTATGGTCCCCTT No data
Right 985793800 5:1947237-1947259 CAATTTGCCACCAACCACCTTGG No data
985793793_985793804 16 Left 985793793 5:1947205-1947227 CCTGAAGGGTGTATGGTCCCCTT No data
Right 985793804 5:1947244-1947266 CCACCAACCACCTTGGGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985793793 Original CRISPR AAGGGGACCATACACCCTTC AGG (reversed) Intergenic
No off target data available for this crispr