ID: 985793796

View in Genome Browser
Species Human (GRCh38)
Location 5:1947224-1947246
Sequence TGGCAAATTGTCTTGGGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985793796_985793801 -9 Left 985793796 5:1947224-1947246 CCTTTCCCCAAGACAATTTGCCA No data
Right 985793801 5:1947238-1947260 AATTTGCCACCAACCACCTTGGG No data
985793796_985793804 -3 Left 985793796 5:1947224-1947246 CCTTTCCCCAAGACAATTTGCCA No data
Right 985793804 5:1947244-1947266 CCACCAACCACCTTGGGAGTGGG No data
985793796_985793808 20 Left 985793796 5:1947224-1947246 CCTTTCCCCAAGACAATTTGCCA No data
Right 985793808 5:1947267-1947289 CTTGATTTCTTTCTAAACATTGG No data
985793796_985793800 -10 Left 985793796 5:1947224-1947246 CCTTTCCCCAAGACAATTTGCCA No data
Right 985793800 5:1947237-1947259 CAATTTGCCACCAACCACCTTGG No data
985793796_985793802 -4 Left 985793796 5:1947224-1947246 CCTTTCCCCAAGACAATTTGCCA No data
Right 985793802 5:1947243-1947265 GCCACCAACCACCTTGGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985793796 Original CRISPR TGGCAAATTGTCTTGGGGAA AGG (reversed) Intergenic
No off target data available for this crispr