ID: 985793797

View in Genome Browser
Species Human (GRCh38)
Location 5:1947229-1947251
Sequence GTTGGTGGCAAATTGTCTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985793797_985793804 -8 Left 985793797 5:1947229-1947251 CCCCAAGACAATTTGCCACCAAC No data
Right 985793804 5:1947244-1947266 CCACCAACCACCTTGGGAGTGGG No data
985793797_985793802 -9 Left 985793797 5:1947229-1947251 CCCCAAGACAATTTGCCACCAAC No data
Right 985793802 5:1947243-1947265 GCCACCAACCACCTTGGGAGTGG No data
985793797_985793808 15 Left 985793797 5:1947229-1947251 CCCCAAGACAATTTGCCACCAAC No data
Right 985793808 5:1947267-1947289 CTTGATTTCTTTCTAAACATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985793797 Original CRISPR GTTGGTGGCAAATTGTCTTG GGG (reversed) Intergenic
No off target data available for this crispr