ID: 985793798

View in Genome Browser
Species Human (GRCh38)
Location 5:1947230-1947252
Sequence GGTTGGTGGCAAATTGTCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985793798_985793808 14 Left 985793798 5:1947230-1947252 CCCAAGACAATTTGCCACCAACC No data
Right 985793808 5:1947267-1947289 CTTGATTTCTTTCTAAACATTGG No data
985793798_985793804 -9 Left 985793798 5:1947230-1947252 CCCAAGACAATTTGCCACCAACC No data
Right 985793804 5:1947244-1947266 CCACCAACCACCTTGGGAGTGGG No data
985793798_985793802 -10 Left 985793798 5:1947230-1947252 CCCAAGACAATTTGCCACCAACC No data
Right 985793802 5:1947243-1947265 GCCACCAACCACCTTGGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985793798 Original CRISPR GGTTGGTGGCAAATTGTCTT GGG (reversed) Intergenic
No off target data available for this crispr