ID: 985793799

View in Genome Browser
Species Human (GRCh38)
Location 5:1947231-1947253
Sequence TGGTTGGTGGCAAATTGTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985793799_985793804 -10 Left 985793799 5:1947231-1947253 CCAAGACAATTTGCCACCAACCA No data
Right 985793804 5:1947244-1947266 CCACCAACCACCTTGGGAGTGGG No data
985793799_985793808 13 Left 985793799 5:1947231-1947253 CCAAGACAATTTGCCACCAACCA No data
Right 985793808 5:1947267-1947289 CTTGATTTCTTTCTAAACATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985793799 Original CRISPR TGGTTGGTGGCAAATTGTCT TGG (reversed) Intergenic
No off target data available for this crispr