ID: 985793801

View in Genome Browser
Species Human (GRCh38)
Location 5:1947238-1947260
Sequence AATTTGCCACCAACCACCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985793787_985793801 19 Left 985793787 5:1947196-1947218 CCTCCCTCCCCTGAAGGGTGTAT No data
Right 985793801 5:1947238-1947260 AATTTGCCACCAACCACCTTGGG No data
985793789_985793801 16 Left 985793789 5:1947199-1947221 CCCTCCCCTGAAGGGTGTATGGT No data
Right 985793801 5:1947238-1947260 AATTTGCCACCAACCACCTTGGG No data
985793793_985793801 10 Left 985793793 5:1947205-1947227 CCTGAAGGGTGTATGGTCCCCTT No data
Right 985793801 5:1947238-1947260 AATTTGCCACCAACCACCTTGGG No data
985793795_985793801 -8 Left 985793795 5:1947223-1947245 CCCTTTCCCCAAGACAATTTGCC No data
Right 985793801 5:1947238-1947260 AATTTGCCACCAACCACCTTGGG No data
985793794_985793801 -7 Left 985793794 5:1947222-1947244 CCCCTTTCCCCAAGACAATTTGC No data
Right 985793801 5:1947238-1947260 AATTTGCCACCAACCACCTTGGG No data
985793790_985793801 15 Left 985793790 5:1947200-1947222 CCTCCCCTGAAGGGTGTATGGTC No data
Right 985793801 5:1947238-1947260 AATTTGCCACCAACCACCTTGGG No data
985793785_985793801 24 Left 985793785 5:1947191-1947213 CCTCACCTCCCTCCCCTGAAGGG No data
Right 985793801 5:1947238-1947260 AATTTGCCACCAACCACCTTGGG No data
985793796_985793801 -9 Left 985793796 5:1947224-1947246 CCTTTCCCCAAGACAATTTGCCA No data
Right 985793801 5:1947238-1947260 AATTTGCCACCAACCACCTTGGG No data
985793791_985793801 12 Left 985793791 5:1947203-1947225 CCCCTGAAGGGTGTATGGTCCCC No data
Right 985793801 5:1947238-1947260 AATTTGCCACCAACCACCTTGGG No data
985793792_985793801 11 Left 985793792 5:1947204-1947226 CCCTGAAGGGTGTATGGTCCCCT No data
Right 985793801 5:1947238-1947260 AATTTGCCACCAACCACCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985793801 Original CRISPR AATTTGCCACCAACCACCTT GGG Intergenic
No off target data available for this crispr