ID: 985793808

View in Genome Browser
Species Human (GRCh38)
Location 5:1947267-1947289
Sequence CTTGATTTCTTTCTAAACAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985793803_985793808 0 Left 985793803 5:1947244-1947266 CCACCAACCACCTTGGGAGTGGG No data
Right 985793808 5:1947267-1947289 CTTGATTTCTTTCTAAACATTGG No data
985793799_985793808 13 Left 985793799 5:1947231-1947253 CCAAGACAATTTGCCACCAACCA No data
Right 985793808 5:1947267-1947289 CTTGATTTCTTTCTAAACATTGG No data
985793796_985793808 20 Left 985793796 5:1947224-1947246 CCTTTCCCCAAGACAATTTGCCA No data
Right 985793808 5:1947267-1947289 CTTGATTTCTTTCTAAACATTGG No data
985793794_985793808 22 Left 985793794 5:1947222-1947244 CCCCTTTCCCCAAGACAATTTGC No data
Right 985793808 5:1947267-1947289 CTTGATTTCTTTCTAAACATTGG No data
985793807_985793808 -10 Left 985793807 5:1947254-1947276 CCTTGGGAGTGGGCTTGATTTCT No data
Right 985793808 5:1947267-1947289 CTTGATTTCTTTCTAAACATTGG No data
985793798_985793808 14 Left 985793798 5:1947230-1947252 CCCAAGACAATTTGCCACCAACC No data
Right 985793808 5:1947267-1947289 CTTGATTTCTTTCTAAACATTGG No data
985793797_985793808 15 Left 985793797 5:1947229-1947251 CCCCAAGACAATTTGCCACCAAC No data
Right 985793808 5:1947267-1947289 CTTGATTTCTTTCTAAACATTGG No data
985793795_985793808 21 Left 985793795 5:1947223-1947245 CCCTTTCCCCAAGACAATTTGCC No data
Right 985793808 5:1947267-1947289 CTTGATTTCTTTCTAAACATTGG No data
985793805_985793808 -3 Left 985793805 5:1947247-1947269 CCAACCACCTTGGGAGTGGGCTT No data
Right 985793808 5:1947267-1947289 CTTGATTTCTTTCTAAACATTGG No data
985793806_985793808 -7 Left 985793806 5:1947251-1947273 CCACCTTGGGAGTGGGCTTGATT No data
Right 985793808 5:1947267-1947289 CTTGATTTCTTTCTAAACATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985793808 Original CRISPR CTTGATTTCTTTCTAAACAT TGG Intergenic
No off target data available for this crispr