ID: 985794256

View in Genome Browser
Species Human (GRCh38)
Location 5:1950236-1950258
Sequence CTCTCGGTGTGGAGGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985794242_985794256 19 Left 985794242 5:1950194-1950216 CCAAGTTCACAGAGTCCCGGGGA No data
Right 985794256 5:1950236-1950258 CTCTCGGTGTGGAGGGAAGAGGG No data
985794244_985794256 4 Left 985794244 5:1950209-1950231 CCCGGGGAGCTGATCGGCCACCA No data
Right 985794256 5:1950236-1950258 CTCTCGGTGTGGAGGGAAGAGGG No data
985794245_985794256 3 Left 985794245 5:1950210-1950232 CCGGGGAGCTGATCGGCCACCAG No data
Right 985794256 5:1950236-1950258 CTCTCGGTGTGGAGGGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985794256 Original CRISPR CTCTCGGTGTGGAGGGAAGA GGG Intergenic
No off target data available for this crispr