ID: 985795823

View in Genome Browser
Species Human (GRCh38)
Location 5:1961605-1961627
Sequence GACCAGGACGTGGCTCCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985795823_985795827 -10 Left 985795823 5:1961605-1961627 CCAGGTGGAGCCACGTCCTGGTC No data
Right 985795827 5:1961618-1961640 CGTCCTGGTCACTCGGATTCGGG No data
985795823_985795829 -4 Left 985795823 5:1961605-1961627 CCAGGTGGAGCCACGTCCTGGTC No data
Right 985795829 5:1961624-1961646 GGTCACTCGGATTCGGGACCTGG No data
985795823_985795833 28 Left 985795823 5:1961605-1961627 CCAGGTGGAGCCACGTCCTGGTC No data
Right 985795833 5:1961656-1961678 TGCACCTCTTCAGCACCCTTGGG No data
985795823_985795834 29 Left 985795823 5:1961605-1961627 CCAGGTGGAGCCACGTCCTGGTC No data
Right 985795834 5:1961657-1961679 GCACCTCTTCAGCACCCTTGGGG No data
985795823_985795832 27 Left 985795823 5:1961605-1961627 CCAGGTGGAGCCACGTCCTGGTC No data
Right 985795832 5:1961655-1961677 CTGCACCTCTTCAGCACCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985795823 Original CRISPR GACCAGGACGTGGCTCCACC TGG (reversed) Intergenic
No off target data available for this crispr