ID: 985795953

View in Genome Browser
Species Human (GRCh38)
Location 5:1962235-1962257
Sequence TTTTCATGAAACAAATCAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985795953_985795956 5 Left 985795953 5:1962235-1962257 CCCTTTGATTTGTTTCATGAAAA No data
Right 985795956 5:1962263-1962285 TTTCCTAGAAGGCGCCCACCTGG No data
985795953_985795955 -6 Left 985795953 5:1962235-1962257 CCCTTTGATTTGTTTCATGAAAA No data
Right 985795955 5:1962252-1962274 TGAAAAGTTTGTTTCCTAGAAGG No data
985795953_985795961 28 Left 985795953 5:1962235-1962257 CCCTTTGATTTGTTTCATGAAAA No data
Right 985795961 5:1962286-1962308 CAGAGAGACACATCTGCTGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985795953 Original CRISPR TTTTCATGAAACAAATCAAA GGG (reversed) Intergenic
No off target data available for this crispr