ID: 985795954

View in Genome Browser
Species Human (GRCh38)
Location 5:1962236-1962258
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985795954_985795956 4 Left 985795954 5:1962236-1962258 CCTTTGATTTGTTTCATGAAAAG No data
Right 985795956 5:1962263-1962285 TTTCCTAGAAGGCGCCCACCTGG No data
985795954_985795955 -7 Left 985795954 5:1962236-1962258 CCTTTGATTTGTTTCATGAAAAG No data
Right 985795955 5:1962252-1962274 TGAAAAGTTTGTTTCCTAGAAGG No data
985795954_985795961 27 Left 985795954 5:1962236-1962258 CCTTTGATTTGTTTCATGAAAAG No data
Right 985795961 5:1962286-1962308 CAGAGAGACACATCTGCTGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985795954 Original CRISPR CTTTTCATGAAACAAATCAA AGG (reversed) Intergenic