ID: 985795955

View in Genome Browser
Species Human (GRCh38)
Location 5:1962252-1962274
Sequence TGAAAAGTTTGTTTCCTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985795954_985795955 -7 Left 985795954 5:1962236-1962258 CCTTTGATTTGTTTCATGAAAAG No data
Right 985795955 5:1962252-1962274 TGAAAAGTTTGTTTCCTAGAAGG No data
985795953_985795955 -6 Left 985795953 5:1962235-1962257 CCCTTTGATTTGTTTCATGAAAA No data
Right 985795955 5:1962252-1962274 TGAAAAGTTTGTTTCCTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985795955 Original CRISPR TGAAAAGTTTGTTTCCTAGA AGG Intergenic