ID: 985795956

View in Genome Browser
Species Human (GRCh38)
Location 5:1962263-1962285
Sequence TTTCCTAGAAGGCGCCCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985795954_985795956 4 Left 985795954 5:1962236-1962258 CCTTTGATTTGTTTCATGAAAAG No data
Right 985795956 5:1962263-1962285 TTTCCTAGAAGGCGCCCACCTGG No data
985795953_985795956 5 Left 985795953 5:1962235-1962257 CCCTTTGATTTGTTTCATGAAAA No data
Right 985795956 5:1962263-1962285 TTTCCTAGAAGGCGCCCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985795956 Original CRISPR TTTCCTAGAAGGCGCCCACC TGG Intergenic
No off target data available for this crispr