ID: 985795956 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:1962263-1962285 |
| Sequence | TTTCCTAGAAGGCGCCCACC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 985795954_985795956 | 4 | Left | 985795954 | 5:1962236-1962258 | CCTTTGATTTGTTTCATGAAAAG | No data | ||
| Right | 985795956 | 5:1962263-1962285 | TTTCCTAGAAGGCGCCCACCTGG | No data | ||||
| 985795953_985795956 | 5 | Left | 985795953 | 5:1962235-1962257 | CCCTTTGATTTGTTTCATGAAAA | No data | ||
| Right | 985795956 | 5:1962263-1962285 | TTTCCTAGAAGGCGCCCACCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 985795956 | Original CRISPR | TTTCCTAGAAGGCGCCCACC TGG | Intergenic | ||
| No off target data available for this crispr | |||||