ID: 985795957

View in Genome Browser
Species Human (GRCh38)
Location 5:1962266-1962288
Sequence CTGCCAGGTGGGCGCCTTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985795957_985795962 9 Left 985795957 5:1962266-1962288 CCTAGAAGGCGCCCACCTGGCAG No data
Right 985795962 5:1962298-1962320 TCTGCTGTCGGCAGCGTTTTAGG No data
985795957_985795961 -3 Left 985795957 5:1962266-1962288 CCTAGAAGGCGCCCACCTGGCAG No data
Right 985795961 5:1962286-1962308 CAGAGAGACACATCTGCTGTCGG No data
985795957_985795963 10 Left 985795957 5:1962266-1962288 CCTAGAAGGCGCCCACCTGGCAG No data
Right 985795963 5:1962299-1962321 CTGCTGTCGGCAGCGTTTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985795957 Original CRISPR CTGCCAGGTGGGCGCCTTCT AGG (reversed) Intergenic