ID: 985795961

View in Genome Browser
Species Human (GRCh38)
Location 5:1962286-1962308
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985795954_985795961 27 Left 985795954 5:1962236-1962258 CCTTTGATTTGTTTCATGAAAAG No data
Right 985795961 5:1962286-1962308 CAGAGAGACACATCTGCTGTCGG No data
985795957_985795961 -3 Left 985795957 5:1962266-1962288 CCTAGAAGGCGCCCACCTGGCAG No data
Right 985795961 5:1962286-1962308 CAGAGAGACACATCTGCTGTCGG No data
985795953_985795961 28 Left 985795953 5:1962235-1962257 CCCTTTGATTTGTTTCATGAAAA No data
Right 985795961 5:1962286-1962308 CAGAGAGACACATCTGCTGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type