ID: 985797209

View in Genome Browser
Species Human (GRCh38)
Location 5:1972141-1972163
Sequence GGCCCCCGGAGCCCCCGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985797209_985797216 6 Left 985797209 5:1972141-1972163 CCTGCTCGGGGGCTCCGGGGGCC No data
Right 985797216 5:1972170-1972192 ACCACAGGGCGGCCTGGAAGCGG No data
985797209_985797212 -8 Left 985797209 5:1972141-1972163 CCTGCTCGGGGGCTCCGGGGGCC No data
Right 985797212 5:1972156-1972178 CGGGGGCCATGCTGACCACAGGG No data
985797209_985797215 0 Left 985797209 5:1972141-1972163 CCTGCTCGGGGGCTCCGGGGGCC No data
Right 985797215 5:1972164-1972186 ATGCTGACCACAGGGCGGCCTGG No data
985797209_985797220 24 Left 985797209 5:1972141-1972163 CCTGCTCGGGGGCTCCGGGGGCC No data
Right 985797220 5:1972188-1972210 AGCGGTGCTGATGCTAGCGGAGG No data
985797209_985797213 -5 Left 985797209 5:1972141-1972163 CCTGCTCGGGGGCTCCGGGGGCC No data
Right 985797213 5:1972159-1972181 GGGCCATGCTGACCACAGGGCGG No data
985797209_985797219 21 Left 985797209 5:1972141-1972163 CCTGCTCGGGGGCTCCGGGGGCC No data
Right 985797219 5:1972185-1972207 GGAAGCGGTGCTGATGCTAGCGG No data
985797209_985797211 -9 Left 985797209 5:1972141-1972163 CCTGCTCGGGGGCTCCGGGGGCC No data
Right 985797211 5:1972155-1972177 CCGGGGGCCATGCTGACCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985797209 Original CRISPR GGCCCCCGGAGCCCCCGAGC AGG (reversed) Intergenic
No off target data available for this crispr