ID: 985797212

View in Genome Browser
Species Human (GRCh38)
Location 5:1972156-1972178
Sequence CGGGGGCCATGCTGACCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985797209_985797212 -8 Left 985797209 5:1972141-1972163 CCTGCTCGGGGGCTCCGGGGGCC No data
Right 985797212 5:1972156-1972178 CGGGGGCCATGCTGACCACAGGG No data
985797200_985797212 10 Left 985797200 5:1972123-1972145 CCTTGCTGTCTGGGTCTACCTGC No data
Right 985797212 5:1972156-1972178 CGGGGGCCATGCTGACCACAGGG No data
985797199_985797212 14 Left 985797199 5:1972119-1972141 CCAGCCTTGCTGTCTGGGTCTAC No data
Right 985797212 5:1972156-1972178 CGGGGGCCATGCTGACCACAGGG No data
985797196_985797212 27 Left 985797196 5:1972106-1972128 CCAGGCTTCTCTGCCAGCCTTGC No data
Right 985797212 5:1972156-1972178 CGGGGGCCATGCTGACCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985797212 Original CRISPR CGGGGGCCATGCTGACCACA GGG Intergenic
No off target data available for this crispr