ID: 985797215

View in Genome Browser
Species Human (GRCh38)
Location 5:1972164-1972186
Sequence ATGCTGACCACAGGGCGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985797209_985797215 0 Left 985797209 5:1972141-1972163 CCTGCTCGGGGGCTCCGGGGGCC No data
Right 985797215 5:1972164-1972186 ATGCTGACCACAGGGCGGCCTGG No data
985797199_985797215 22 Left 985797199 5:1972119-1972141 CCAGCCTTGCTGTCTGGGTCTAC No data
Right 985797215 5:1972164-1972186 ATGCTGACCACAGGGCGGCCTGG No data
985797200_985797215 18 Left 985797200 5:1972123-1972145 CCTTGCTGTCTGGGTCTACCTGC No data
Right 985797215 5:1972164-1972186 ATGCTGACCACAGGGCGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985797215 Original CRISPR ATGCTGACCACAGGGCGGCC TGG Intergenic
No off target data available for this crispr