ID: 985797220

View in Genome Browser
Species Human (GRCh38)
Location 5:1972188-1972210
Sequence AGCGGTGCTGATGCTAGCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985797209_985797220 24 Left 985797209 5:1972141-1972163 CCTGCTCGGGGGCTCCGGGGGCC No data
Right 985797220 5:1972188-1972210 AGCGGTGCTGATGCTAGCGGAGG No data
985797210_985797220 10 Left 985797210 5:1972155-1972177 CCGGGGGCCATGCTGACCACAGG No data
Right 985797220 5:1972188-1972210 AGCGGTGCTGATGCTAGCGGAGG No data
985797217_985797220 -6 Left 985797217 5:1972171-1972193 CCACAGGGCGGCCTGGAAGCGGT No data
Right 985797220 5:1972188-1972210 AGCGGTGCTGATGCTAGCGGAGG No data
985797214_985797220 3 Left 985797214 5:1972162-1972184 CCATGCTGACCACAGGGCGGCCT No data
Right 985797220 5:1972188-1972210 AGCGGTGCTGATGCTAGCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985797220 Original CRISPR AGCGGTGCTGATGCTAGCGG AGG Intergenic
No off target data available for this crispr