ID: 985797527

View in Genome Browser
Species Human (GRCh38)
Location 5:1974049-1974071
Sequence CTGGCTTTCAGCTGAGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985797520_985797527 -3 Left 985797520 5:1974029-1974051 CCAAAGAAGGCTGGTCCACACTG No data
Right 985797527 5:1974049-1974071 CTGGCTTTCAGCTGAGGGGAGGG No data
985797519_985797527 1 Left 985797519 5:1974025-1974047 CCAGCCAAAGAAGGCTGGTCCAC No data
Right 985797527 5:1974049-1974071 CTGGCTTTCAGCTGAGGGGAGGG No data
985797516_985797527 10 Left 985797516 5:1974016-1974038 CCGTCTACACCAGCCAAAGAAGG No data
Right 985797527 5:1974049-1974071 CTGGCTTTCAGCTGAGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985797527 Original CRISPR CTGGCTTTCAGCTGAGGGGA GGG Intergenic
No off target data available for this crispr