ID: 985798651

View in Genome Browser
Species Human (GRCh38)
Location 5:1985866-1985888
Sequence GCATCTGCTGGGCTAGGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985798651_985798663 30 Left 985798651 5:1985866-1985888 CCTCCACCTAGCCCAGCAGATGC No data
Right 985798663 5:1985919-1985941 CTGGCCCTGAGCTTCTCTCTGGG No data
985798651_985798662 29 Left 985798651 5:1985866-1985888 CCTCCACCTAGCCCAGCAGATGC No data
Right 985798662 5:1985918-1985940 CCTGGCCCTGAGCTTCTCTCTGG No data
985798651_985798659 11 Left 985798651 5:1985866-1985888 CCTCCACCTAGCCCAGCAGATGC No data
Right 985798659 5:1985900-1985922 TTTATCCATCGATGCTGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985798651 Original CRISPR GCATCTGCTGGGCTAGGTGG AGG (reversed) Intergenic
No off target data available for this crispr