ID: 985798652

View in Genome Browser
Species Human (GRCh38)
Location 5:1985869-1985891
Sequence GGAGCATCTGCTGGGCTAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985798652_985798663 27 Left 985798652 5:1985869-1985891 CCACCTAGCCCAGCAGATGCTCC No data
Right 985798663 5:1985919-1985941 CTGGCCCTGAGCTTCTCTCTGGG No data
985798652_985798662 26 Left 985798652 5:1985869-1985891 CCACCTAGCCCAGCAGATGCTCC No data
Right 985798662 5:1985918-1985940 CCTGGCCCTGAGCTTCTCTCTGG No data
985798652_985798659 8 Left 985798652 5:1985869-1985891 CCACCTAGCCCAGCAGATGCTCC No data
Right 985798659 5:1985900-1985922 TTTATCCATCGATGCTGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985798652 Original CRISPR GGAGCATCTGCTGGGCTAGG TGG (reversed) Intergenic
No off target data available for this crispr