ID: 985798653

View in Genome Browser
Species Human (GRCh38)
Location 5:1985872-1985894
Sequence CCTGGAGCATCTGCTGGGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985798653_985798659 5 Left 985798653 5:1985872-1985894 CCTAGCCCAGCAGATGCTCCAGG No data
Right 985798659 5:1985900-1985922 TTTATCCATCGATGCTGTCCTGG No data
985798653_985798662 23 Left 985798653 5:1985872-1985894 CCTAGCCCAGCAGATGCTCCAGG No data
Right 985798662 5:1985918-1985940 CCTGGCCCTGAGCTTCTCTCTGG No data
985798653_985798663 24 Left 985798653 5:1985872-1985894 CCTAGCCCAGCAGATGCTCCAGG No data
Right 985798663 5:1985919-1985941 CTGGCCCTGAGCTTCTCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985798653 Original CRISPR CCTGGAGCATCTGCTGGGCT AGG (reversed) Intergenic
No off target data available for this crispr