ID: 985798656

View in Genome Browser
Species Human (GRCh38)
Location 5:1985877-1985899
Sequence GTCCACCTGGAGCATCTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985798656_985798662 18 Left 985798656 5:1985877-1985899 CCCAGCAGATGCTCCAGGTGGAC No data
Right 985798662 5:1985918-1985940 CCTGGCCCTGAGCTTCTCTCTGG No data
985798656_985798663 19 Left 985798656 5:1985877-1985899 CCCAGCAGATGCTCCAGGTGGAC No data
Right 985798663 5:1985919-1985941 CTGGCCCTGAGCTTCTCTCTGGG No data
985798656_985798666 26 Left 985798656 5:1985877-1985899 CCCAGCAGATGCTCCAGGTGGAC No data
Right 985798666 5:1985926-1985948 TGAGCTTCTCTCTGGGCTGCTGG No data
985798656_985798667 27 Left 985798656 5:1985877-1985899 CCCAGCAGATGCTCCAGGTGGAC No data
Right 985798667 5:1985927-1985949 GAGCTTCTCTCTGGGCTGCTGGG No data
985798656_985798659 0 Left 985798656 5:1985877-1985899 CCCAGCAGATGCTCCAGGTGGAC No data
Right 985798659 5:1985900-1985922 TTTATCCATCGATGCTGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985798656 Original CRISPR GTCCACCTGGAGCATCTGCT GGG (reversed) Intergenic
No off target data available for this crispr