ID: 985798659

View in Genome Browser
Species Human (GRCh38)
Location 5:1985900-1985922
Sequence TTTATCCATCGATGCTGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985798651_985798659 11 Left 985798651 5:1985866-1985888 CCTCCACCTAGCCCAGCAGATGC No data
Right 985798659 5:1985900-1985922 TTTATCCATCGATGCTGTCCTGG No data
985798656_985798659 0 Left 985798656 5:1985877-1985899 CCCAGCAGATGCTCCAGGTGGAC No data
Right 985798659 5:1985900-1985922 TTTATCCATCGATGCTGTCCTGG No data
985798652_985798659 8 Left 985798652 5:1985869-1985891 CCACCTAGCCCAGCAGATGCTCC No data
Right 985798659 5:1985900-1985922 TTTATCCATCGATGCTGTCCTGG No data
985798650_985798659 15 Left 985798650 5:1985862-1985884 CCTGCCTCCACCTAGCCCAGCAG No data
Right 985798659 5:1985900-1985922 TTTATCCATCGATGCTGTCCTGG No data
985798657_985798659 -1 Left 985798657 5:1985878-1985900 CCAGCAGATGCTCCAGGTGGACT No data
Right 985798659 5:1985900-1985922 TTTATCCATCGATGCTGTCCTGG No data
985798649_985798659 28 Left 985798649 5:1985849-1985871 CCATGATTTATCTCCTGCCTCCA No data
Right 985798659 5:1985900-1985922 TTTATCCATCGATGCTGTCCTGG No data
985798653_985798659 5 Left 985798653 5:1985872-1985894 CCTAGCCCAGCAGATGCTCCAGG No data
Right 985798659 5:1985900-1985922 TTTATCCATCGATGCTGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985798659 Original CRISPR TTTATCCATCGATGCTGTCC TGG Intergenic
No off target data available for this crispr